Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB46YB17FM1
Length(NT) : 659
Best Gene Model Blast : Link to GSTUMT00012114001 E-value : 2e-89
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE61634.1| Score: 365 E_value: 1e-63
KEGG Definition: molecular chaperone (HSP90 family); K04079 molecular chaperone HtpG
Accession: aor:AO090102000620 Score: 365 E_value: 5e-64
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0019 Score: 324 E_value: 5e-31
PFAM Definition: No Hit Found
Swissprot: O43109|HSP90_PODAN

Sequence:
>SY0AAB46YB17FM1
TTGGAAACACTCTCGACTTTTCTCAGAGCCCAATCAATTTCTCCTGCATC
TCCTCATTCACCTCTCTATTTCCCTGCACCTTTAGAGATTCATAGACCCG
AGAAGATAGCAAACAACCATTGCCATGGCTGAAACCTTCGAATTCCAAGC
TGAGATCTCTCAGTTGCTCTCCCTCATCATTAATACTGTATACTCGAATA
AGGAGATTTTCCTTCGAGAATTGATCTCCAATGCCTCAGACGCTTTGGAC
AAGATTCGCTACATTTCTCTTTCCGACGCTAGCGTCTTGGAAGAGGAGAA
GGATCTGAAAATTCACATTATCCCTAACAAGGAGGCCAAGACTCTTTCAA
TGTATGTTCCCTGATTTTTATGGAAGCTTCTTTAGTTTTGCTGATTGATG
TTTTGAATTTAGTTTTGATACTGGTATCGGCTTTACTAAATCTGATTTGG
TAAACAATCTTGGTACCATTGCCCGATCTGGTACAAAGCAGTTCATGGAG
GCCCTGTCCGCAGGTGCTGATATCTCGATGATTGGTCAATTTGGTGTTGG
TTTCTACTCGGCATATCTTGTTGCCGATAAGGTTGAGGTTGTTACCAAGT
CGAACGAAGATGAACAATACATCTGGGAGTCGGCTGCTGGTGGTTCTTTT
ACTATCAAA

Sequences in the Contig:

SY0AAB46YB17FM1