Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB45YO11FM1
Length(NT) : 668
Best Gene Model Blast : Link to GSTUMT00012106001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_12667
Accession: ref|XP_001586092.1| Score: 208 E_value: 4e-15
KEGG Definition: hypothetical protein
Accession: ang:An09g06630 Score: 205 E_value: 5e-15
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P20824|NUC1_NEUCR

Sequence:
>SY0AAB45YO11FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCAACACCATCACCATCACC
ACCAACAGCACCAACACCAGCAGGAACACCATTCGCAAATGCTAGCTCGC
CAACACATGATACAGGGTGGGATGATCCCCCCTACCCCCTCGAGTATCGA
CCTTCAGACCGGCCTTCCACATGGCCCGTGCTCGCATATGGGTTCGCAAT
CGGATATCATGATGGAAAGGTATAATAGTTTAAGAGATGAGCAGATGATA
TTTACACCTCTGGTTTCACCTGCGGTCACTCCCCTGGACACCAACTTTGT
ACACCAGGTTCCTGAATTCACAATACCCGGCTACTTTAGCCCTTTGACCT
CTCCTGCCCTCGATGCTCACCCTCATAGGACCCATATGCCCAATCCACAT
ATGATGCACACCCACTCCCAATCGGCATCTCCGATTGGACCCAGTTGACT
CCCCGAACATCAATAAACGGGGAAGCACAGGCCGACGAAAATCGACCACG
TCCCGTAATCCTGCCCGGGTGGTCCGGGAGTCGCCAAGCATGAAGGCGCA
GAGGAAGAAGTTACCAGCAGCATTGGCCGCAACCCCAGAGCTCGCGAATG
CACTTTCGAAACAGCCCCCAACCCCCACGGCGGTCCGGCAAAGTGCATCA
CAATGCCGGGGTCGGGAG

Sequences in the Contig:

SY0AAB45YO11FM1