Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB45YM10FM1
Length(NT) : 513
Best Gene Model Blast : Link to GSTUMT00009426001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: glyceraldehyde 3-phosphate dehydrogenase
Accession: gb|AAT76626.1| Score: 575 E_value: 6e-58
KEGG Definition: GLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE (GAPDH) (CLOCK-CONTROLLED PROTEIN 7)
Accession: ncr:NCU01528.1 Score: 557 E_value: 4e-56
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG0657 Score: 342 E_value: 2e-33
PFAM Definition: Gp_dh_C, Glyceraldehyde 3-phosphate dehydrogenase, C-terminal domain. GAPDH is a tetrameric NAD-binding enzyme involved in glycolysis and glyconeogenesis. C-terminal domain is a mixed alpha/antiparallel beta fold..
Pfam Number: pfam02800 Score: 454 E_value: 2e-46
Swissprot: Q8WZN0|G3P_SORMA

Sequence:
>SY0AAB45YM10FM1
CGACCAACATTATTCCTAGTAGCACTGGCGCAGCCAAGGCTGTTGGTAAA
GTTATACCAGAGCTTAACGGGAAACTTACGGGCATGGCTATGCGTGTGCC
TACCCAGAACGTGTCTGTGGTTGATCTCACAATTCGTCTCAAGAATGGCA
CCAGTTATGATCGGATCAAAAAGGCTGTTAGAGAGGCCGCTGAAGGGCCT
TATAAAGGAATAATTGCGTATACCGAGGATGAGCTAGTGTCTAGTGATTT
GAACGGTCACGAAGCATCTTGTATTTTTGATGCGAAAGCAGGGATTCCAT
TGAATGAGAATTTTGTCAAGCTGATTGCTTGGTACGATAACGAATGGGGC
TACTCTCGTCGGGTTCTCGACCTCATCTCATATATCGCAAAAGTTGATGC
TAAATAGATAGGGAATACCTTCAGTTTCTCTATTGCTTGAATTTTGTAGG
GTGTTATGCTCGATAGCTGATAGCTTATAGGCAATATTTGCCTCTATGTT
CCTATATAAAATT

Sequences in the Contig:

SY0AAB45YM10FM1