Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB45YL22FM1
Length(NT) : 547
Best Gene Model Blast : Link to GSTUMT00004896001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An07g04810
Accession: ref|XP_001391564.1| Score: 501 E_value: 1e-70
KEGG Definition: hypothetical protein
Accession: ang:An07g04810 Score: 501 E_value: 7e-71
KOG Definition:
Classification: [Inorganic ion transport and metabolism].
Kog Number: KOG1172 Score: 280 E_value: 4e-26
PFAM Definition: HCO3_cotransp, HCO3- transporter family. This family contains Band 3 anion exchange proteins that exchange CL-/HCO3-. This family also includes cotransporters of Na+/HCO3-..
Pfam Number: pfam00955 Score: 187 E_value: 3e-15
Swissprot: Q9HGM6|YHW5_SCHPO
Gene Ontology:
GO:0005773 = Cellular component: vacuole

Sequence:
>SY0AAB45YL22FM1
TTGGCTTTTCGTTACTCAATTCTGTTATCTATTTTCATAAGGCAGTGCAA
GAACTAGAGAGGTCACATGCGAATACCTCATTTGCCTCGTTTCTATATTC
CATCATTGGATGTGTTGGAACGTTTTTGGTCGCAGTGACCTTAAGCACGG
CGAATAGCTGGGCTCCACTCTTCCACAAATGTTAGGATGGGACTGGCAGA
GTATGCTGCCGCAATATCAATTGTCATATTTATCGCCATGCCTCATATTG
GAGAATTGAATAGCCTGGATCAGCAAAGGCTCCCCGTGTCCACTTCCTTC
CGTCCGACTTCCCCCGAAAGGACTCGTTTCATTGTCGAATTCTGGACCCT
ACCCGCGAGCTGGATATTTGCTGCTATACTGCCTGGCCTGATCATAACCA
CCCTTTTCTTCTTCGATGTTGAGGTTTCCACTATCTGTGCAACGCTCTCT
CGATATAACATAAGGAAGCCAGGCGGATATGCTTGGGACGTAGCACTTTT
GGGCACAACAACAGCGCTGTGTGGTATTCTCGGGATTCCACCAGCTA

Sequences in the Contig:

SY0AAB45YL22FM1