Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB45YI19FM1
Length(NT) : 460
Best Gene Model Blast : Link to GSTUMT00007219001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: ankyrin repeat domain protein
Accession: ref|XP_001273619.1| Score: 322 E_value: 1e-28
KEGG Definition: ankyrin repeat protein
Accession: afm:AFUA_3G02830 Score: 308 E_value: 2e-27
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4412 Score: 194 E_value: 3e-16
PFAM Definition: No Hit Found
Swissprot: Q25338|LITD_LATMA

Sequence:
>SY0AAB45YI19FM1
TTGGCCATTATATGGTGCTACTGCGGCTAGGGAGGAGGGAGTAGTGAAAA
TGCTACTCGGACGGGACGACGTCGACCCCAACAAACCAAACAACAACGGC
CTAACACCACTCTATTTTGCTACTATGAATAGGGATGAGGGAATTGTGAG
AGCGCTACTCGACCGGGACGACGTCGACCCCAACAAACCAAACAACAGCG
GCCTAACACCACTCTATTTTGCTACTATGAATAGGGATGAGGGAATTGTG
AGAGCGCTACTCGACCGGGACGACGTCGACCCCAACAAACCAGACAACAA
CGGCCTAACACCACTCCATTTTGCTATTATGAATGGGGATGAGGGAATTG
TGAGAGCGCTACTCGACAGGGACGACGTCGACCCCAACAAACCAAAAAAC
GACGGCCTAACACCACTCTATTTTGCTACTATTCATAGGGATGAGGGAGT
AGTGAAAATG

Sequences in the Contig:

SY0AAB45YI19FM1