Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB45YG14FM1
Length(NT) : 591
Best Gene Model Blast : Link to GSTUMT00000246001 E-value : 2e-61
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: emb|CAG01241.1| Score: 190 E_value: 7e-16
KEGG Definition: RCJMB04_7i20, UBE2D3; ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) [EC:6.3.2.19]; K06689 ubiquitin-conjugating enzyme E2 D/E
Accession: gga:422713 Score: 176 E_value: 6e-15
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0417 Score: 168 E_value: 4e-13
PFAM Definition: No Hit Found
Swissprot: P61078|UB2D3_RAT
Gene Ontology:
GO:0004842 = Molecular function: ubiquitin-protein ligase activity

Sequence:
>SY0AAB45YG14FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCTCAACTTCCACAACAACT
CAACTCTCTCCTGTTCTTACCTTTGTCAATCCTTCCCTATTCTTTACTTT
ACGCTTCACTCCGTCACTCCTACAACCTTCAATAGCAATACTCCCATAAC
AACCAGTTCGAAATGGCCCTCAAGAGAATTAACAAGGAACTCAGCGATCT
CGGAAGGTATGGTTTTCCTCCCTATGCTACAGCAAAAATCGGTCTTCGCT
TCGGCTCCCGTTGAGAGTTCGCGTGAGGGGGCGTTGCCTGGCTATCGGCT
GAAAGCTATTGCTTGCTAACTGTTTACCTCTAGAGATCCACCCTCATCAT
GCAGTGCCGGTCCTATTGGCGAGGATTTGTTTCATTGGCAAGCAACCATT
ATGGGTCCTGTATGTTGACCCCTGCTTGATAGCCTCCTTCAACAAGGCAT
AGTTGAGCCATAAGGCCCGGCTTGGATCATAACCGAGGCGAACGTATTTT
CTGACCCGTGCTTTTGTCATCCTCAGGCAGATAGTCCTTACTCCTCTGGG
GTATTCTTTTTATCCATCGCTTTCCCCACCGACTACCCTTT

Sequences in the Contig:

SY0AAB45YG14FM1