Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB45YE14FM1
Length(NT) : 499
Best Gene Model Blast : Link to GSTUMT00000734001 E-value : 1e-166
Numbers of ESTs : 1

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001546902.1| Score: 191 E_value: 2e-13
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB45YE14FM1
TTGGCTTTAAATATCTTATTCACCATGGGGAAAGCAAATAAAGCGCTCCG
AGATTTCATCAACGATATTCCGGATTCAAAGCTGACGGGATTTCCGGAGA
GCGGTGGAACGATTTACTCTGATCGAGACTTCCGCCTGGATATGCAATGC
AAGACAAGCAACGGCGGATACAACCTCCAAATCCAAATTAACAAGGGGAC
GACAATCACAAGTCTTAGGTCTTCAGCTCCGCGAACGGTGGCTGGGCCAG
TTCTTGCTACGGGCACCGAATCGGCTAGTGTCATTCGGGCCAACTTCATC
GCCCTTATGAAGATCTGACATATTTTGGACTTGTCCCTTGTTTTATCCCA
TGGGGGTTGTTGGACCGGGGCTGCTGTCGGATAGAGTAGGGGTTTGAGGG
GTTGGGAGAAGGAGAAGTTTTGATTTTAGTTAAGGTAGTGAGCGGTTGGG
CAGATGAGATATTAAAGTCAAGAAAGCGCGAAGAGAATAAAGTATAATG

Sequences in the Contig:

SY0AAB45YE14FM1