Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB45YB16FM1
Length(NT) : 568
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CHGG_05941
Accession: ref|XP_001222036.1| Score: 239 E_value: 7e-19
KEGG Definition: hypothetical protein
Accession: mgr:MGG_04740 Score: 218 E_value: 1e-16
KOG Definition: No Hit Found
PFAM Definition: Pkr1, ER protein Pkr1. Pkr1 has been identified as an ER protein of unknown function..
Pfam Number: pfam08636 Score: 259 E_value: 1e-23
Swissprot: Q03880|PKR1_YEAST
Gene Ontology:
GO:0005789 = Cellular component: endoplasmic reticulum membrane
GO:0006461 = Biological process: protein complex assembly

Sequence:
>SY0AAB45YB16FM1
TTGGATCCCATCCATCAAAGTCACGAAAAGCGCCCCGCCCCAAAAAACCA
ATACCCACAATCAAACAACCAAACGCCAAAAAAAAAATGGCAACCTTCGC
CACAGGTCTCTGGAACTCCATCTTCACACCGGGCACCAACTCCTCTCTTG
TGCTAGCAACGCACGCCTCCTTCTTCGCGCTGCAGGTAACCTTCCTCGCG
CTCCTGGCCGGCACGCACAGCTACCACTTCATCATCTTGAGCTTCATCTG
CGCCGGTCTGTGGATGGGGATAACGTGGTTCATCCGGGAGATTGATATTT
TGAAGAAGGAGCAGGAAGAGGTTAAGGAGAGGCTTGGCGTGGATATGCGG
CGGAAGGTGAAGGGGGGGGAGTAATGTTTTTGTGTTGTTGGGGATGGTGT
TTGCTTGTTTGTTTGTTGGTGTGGTGGCAATAGATTTGTTATCGGGGGTG
CGTGTAATGGGGCATAATGTTGGGTGGATTGATTGTTAAAGCGTGGGAAT
CTACAGTAGACTACATTTCTTCTGGTCCGCAGGTGAATGCCGGTGGTTTG
TGTTGCGAGATAATTTTC

Sequences in the Contig:

SY0AAB45YB16FM1