Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB45YB09FM1
Length(NT) : 706
Best Gene Model Blast : Link to GSTUMT00003467001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: argininosuccinate synthase
Accession: ref|XP_001260062.1| Score: 750 E_value: 7e-78
KEGG Definition: argininosuccinate synthase [EC:6.3.4.5]; K01940 argininosuccinate synthase
Accession: afm:AFUA_2G04310 Score: 747 E_value: 8e-78
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG1706 Score: 553 E_value: 1e-57
PFAM Definition: Arginosuc_synth, Arginosuccinate synthase. This family contains a PP-loop motif..
Pfam Number: pfam00764 Score: 480 E_value: 4e-49
Swissprot: P22768|ASSY_YEAST
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0004055 = Molecular function: argininosuccinate synthase activity
GO:0006526 = Biological process: arginine biosynthetic process
GO:0000053 = Biological process: argininosuccinate metabolic process
GO:0000052 = Biological process: citrulline metabolic process

Sequence:
>SY0AAB45YB09FM1
TTGGCCTTCGAAGCTCGAGTATGAGGGTGGCAAGGTAGCCACCGAGCCTT
TGGATCTCTTTTTGACCGCCAATGCCATCGCTCGCAGACACGGTGTGGGA
AGGATTGATATCGTCGAGAATCGTTTCATTGGGTTGAAATCCCGTGGATG
CTACGAGACTCCTGGCTTGACCATTCTTCGTTCCGCTCATGTAGACTTGG
AAGGTCTTGTTCTCGACAAGGAGATCAGAGCTCTCAGGGATCAATTTGTT
ACCTTCAACTATTCCAAGGTCTTGTACAACGGACTCTACTTCTCGCCTGA
ACGTGAATTCCTCGAGGATTCCATCACGTCCTCCCAGAAGACTGTTAATG
GGAAGGTTCGCTGTCGCGTCTACAAGGGCTCCTTGATTATTCTCGGAAGG
AGCAGTGAGACCAGCAAACTTTACGACATGGCTGAGAGCTCCATGGATGA
AATCGGCACCTCGTTCGCGCCGGTCGATACTACTGGGTTTATCTCGGTCC
AGGCAATTCGCCTCAAAAAGTACGGGGCCCAGAAGCTGCTTGATGGAGAA
GTTCTCTGATTCTATTTTTCTTAATGATACCATAGAATCACCTTTGCCCT
TGTCTTGGGTGTGGTATTCGACTTTGCTTCTTTGTTTCCACCTGGATCTC
GTACTTCTAGGTGTTACCTCGTAATCGAGGGAAAACAGTAGTTGGTTATG
GATAAT

Sequences in the Contig:

SY0AAB45YB09FM1