Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB45YB02FM1
Length(NT) : 501
Best Gene Model Blast : Link to GSTUMT00005515001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: ATP-dependent RNA helicase dbp3
Accession: sp|A7EYW0|DBP3_SCLS1 Score: 548 E_value: 8e-55
KEGG Definition: hypothetical protein
Accession: yli:YALI0D09449g Score: 524 E_value: 2e-52
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG0331 Score: 553 E_value: 7e-58
PFAM Definition: DEAD, DEAD/DEAH box helicase. Members of this family include the DEAD and DEAH box helicases. Helicases are involved in unwinding nucleic acids. The DEAD box helicases are involved in various aspects of RNA metabolism, including nuclear transcription, pre mRNA splicing, ribosome biogenesis, nucleocytoplasmic transport, translation, RNA decay and organellar gene expression..
Pfam Number: pfam00270 Score: 378 E_value: 1e-37
Swissprot: A7EYW0|DBP3_SCLS1

Sequence:
>SY0AAB45YB02FM1
TTGGCTGGAAAGACACTTGCGTTTGCTGTTCCCGCGATTAGACATATTAT
TGCGTTGAAAGCGAGGCAGAAGTCTTCGAAAGGCGTGCGGGCTGTTGTCG
TCTCTCCGACGAGAGAATTGGCGATGCAGATATATGATAGCATGGAAAAG
TATTCCAAAGAAGCGCGACTATCTACGGTGTGTGTCTACGGCGGTGTACC
CAAAGATGAGCAGAGAGCGAAGCTCAAAAGGGCGGACATTGTGGTTGCGA
CTCCGGGACGTCTAAACGACCTTATCGACGAAGGCTCTGCAGACCTCAGT
AATGTCTCATACCTAGTCCTCGACGAAGCAGACAGAATGCTCGATAAAGG
CTTTGAGGAGGACATAAAGCGCATAATCCGCGCCATCCCCTCGCCCACCC
GCCAAACCCTAATGTTCACCGCAACCTGGCCACAATCCGTGCGAAAGCTC
GCCTCAGCCTTCATGACCTCGCCTGCCAAGATAACAATCGGTGGCAGAGA
A

Sequences in the Contig:

SY0AAB45YB02FM1