Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB45YA22FM1
Length(NT) : 447
Best Gene Model Blast : Link to GSTUMT00008225001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein AN1424.2
Accession: ref|XP_659028.1| Score: 262 E_value: 1e-21
KEGG Definition: hypothetical protein
Accession: ani:AN1424.2 Score: 262 E_value: 5e-22
KOG Definition: No Hit Found
PFAM Definition: Myosin_tail_1, Myosin tail. The myosin molecule is a multi-subunit complex made up of two heavy chains and four light chains it is a fundamental contractile protein found in all eukaryote cell types. This family consists of the coiled-coil myosin heavy chain tail region. The coiled-coil is composed of the tail from two molecules of myosin. These can then assemble into the macromolecular thick filament. The coiled-coil region provides the structural backbone the thick filament..
Pfam Number: pfam01576 Score: 104 E_value: 7e-06
Swissprot: Q9URY2|ALP7_SCHPO
Gene Ontology:
GO:0005816 = Cellular component: spindle pole body
GO:0005515 = Molecular function: protein binding
GO:0030953 = Biological process: astral microtubule organization and biogenesis
GO:0007163 = Biological process: establishment and/or maintenance of cell polarity
GO:0000132 = Biological process: establishment of mitotic spindle orientation
GO:0008104 = Biological process: protein localization
GO:0051225 = Biological process: spindle assembly

Sequence:
>SY0AAB45YA22FM1
TTGGCTCCAGTTCCGCCACACCGTCATCCCCGGACTCCACCAACGTCCAG
ACAGAAGTTGAAAAGGTCGCCCGCGAATTGCACTCCCTTTACAAAGCCAA
GCACGAAACTAAAGTCACCGCTTTGAAGAAAAGCTACGAGGCAAGATGGG
AGAAGAAAGTTATCGCCCTCCAAACTGAGCTAGACACGCAGAAGAGGCGC
TGCGGAGAGCTAGAAGCCCAAATCCAGAAGAAGAATGAGGAAGAGGTGGC
CGTCGACATCAAGTACTCCGCTTCCAACGCCGGGGAGCTCGCAGCACTAC
GTGGTGAGGTCAAGAGACTTGGAGATGAGCTCAAAGCCGAGAGACGCGAG
AAAGGGGAATTAGTCGGTGCTGTCGAGGAACTCCTATCTATCCAAGCGAG
CTCTAGCGTTGCGGGAGGGGGGGGATTAGCGGAAGAGCGGGAGAAGG

Sequences in the Contig:

SY0AAB45YA22FM1