Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB44YP17FM1
Length(NT) : 534
Best Gene Model Blast : Link to GSTUMT00007520001 E-value : 1e-139
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_08075
Accession: ref|XP_001552740.1| Score: 166 E_value: 2e-10
KEGG Definition: hypothetical protein
Accession: mgr:MGG_03344 Score: 149 E_value: 9e-11
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB44YP17FM1
TGGTCCTTCTAACCCTCACATCGCAGCTCACGGCTGCGATAGAGGTCTAC
AACAAGGAGAACCCATCCTCCGCGATCTCACTTCCTACGACACATCTCGA
TCACCGCCAAATCCGCATCATCTCCCAAACCCTCCTTAACACCTCCGAAG
ATAAATCCCAATACCGCCTGAGCACTCTCCTACAAGGATGCAACCTTTAT
CACCCCCCACCTCCGCCAAAGCCCGAGCCAGTATTGTCTCCGCTGTCACC
CTCCTCTCGCCCTCAGTAAGCTAACAAAATACCAGACTCAGGAATATAAA
TACCTGATGGCACGCCTCCGCCAGCAAGAAGAAGAGCGGATTTACAACGC
CCTAACAAACAAACCTCAAGACATCTACGAAGAAGAGGACGAATATACTT
TCCAAGACCTTAAATCGCAGCTATCAATAATCGCTAATGTATTACTGTCG
ACGATAGCTACTTCTGTGGCTGTATGGATGGTTGCCAGTGGCTGGGATGT
CCCGCAGAGATTCGCCTTGGCGTTTGCGTCTAGC

Sequences in the Contig:

SY0AAB44YP17FM1