Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB44YP03FM1
Length(NT) : 582
Best Gene Model Blast : Link to GSTUMT00006908001 E-value : 1e-170
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_03145
Accession: ref|XP_001595057.1| Score: 198 E_value: 5e-14
KEGG Definition: hypothetical protein
Accession: ncr:NCU08984.1 Score: 195 E_value: 5e-14
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB44YP03FM1
TTGGGGGTTCGCAAACCTTTATACCGCACTCGGAGACCGTGGCAAAGCCA
AAGGCGAGCGAACGTTTTGCATATTACCCCAGAAGGGTGGAAAAGGATGG
TTTAGGTGCACAAATACCATGGCTCAAGACGAGGTTAATGCGCATGTCAG
TATGTTTCATCCCAAAACCAACCCTTGGTACTTTGAGATGTCGCAATTGG
CCAAAGAACTTGTTGTTCGATGGGCCACCAATGAGTGGTCCTACTTTGCA
TCTGGAGACATGAGAATGTCAATGAATGGGAGAATACCGGGGCGAGACGA
GTGATTATGCCGCGTGTGCCTTTTTTGAGTATGGAATACCGTGAAACAGT
TGATAGCCTTATCTTTTTATAGTATTGCAGATTTAGCTACACTTGACCTT
TCGATTTCCTTTTGAACGTCGGAGGATTCCATATGATATGCTTGCCGCAT
TGCATTATATCGTACACTATGCCCACTATACCGTTATAAACCTGCTGGTC
AAACTCTGCCCGTACAGTGCAGTAGGATAGTAACTTACGAGTACGGTTCC
TCCCCTGTATTCTCCACACCGGATGGCTACCG

Sequences in the Contig:

SY0AAB44YP03FM1