Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB44YO22FM1
Length(NT) : 445
Best Gene Model Blast : Link to GSTUMT00001634001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001538476.1| Score: 203 E_value: 7e-15
KEGG Definition: DNA repair protein Rad50
Accession: afm:AFUA_4G12680 Score: 188 E_value: 2e-13
KOG Definition:
Classification: [Replication, recombination and repair].
Kog Number: KOG0250 Score: 104 E_value: 7e-06
PFAM Definition: No Hit Found

Sequence:
>SY0AAB44YO22FM1
TTGGGGTTCACGCACGATTGAGGAAATGCAAAGTGAGATGCAACGCCTGA
ATGATGGAGCTAAAGTTATCAAAAGAAGAATCAATGTGCTTATCGCGGAA
AAGGAGACTGCTCGCCATTCGATCACCCTTCTTGACGGCCAAGTAAGAGA
TCTTCGGATGAAATTTGGCGAATTGAACTTCAAGATCAGCAAGGCCCAAG
ATCTCGTGAAGCGGATTGAATCTCATAAGCAGGAGGCCGTCATGCATACC
ACCGCTATTGAGGAGATAGATCAAAAGATTAGGGAGCTGGCCCCCAAGAT
ACAACGGGCAGAAGCCAAAGTCCAAATGATACAGGATGATGGGGCTGGGA
AGGAAAACCGACACCAACGGGATGCAATGAAACTCGCTGAGAGTGACATG
CAATTGAAAAGGACTCAACACGGTATTGGCAATTACCTTAACCGT

Sequences in the Contig:

SY0AAB44YO22FM1