Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB44YN11FM1
Length(NT) : 565
Best Gene Model Blast : Link to GSTUMT00011668001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An07g03630
Accession: ref|XP_001391446.1| Score: 146 E_value: 5e-08
KEGG Definition: hypothetical protein
Accession: ang:An07g03630 Score: 146 E_value: 2e-08
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB44YN11FM1
GTTTGCGAGAGAAAGTCTTGTGCTGTTGGCTAGGAGGGGGATTAGTGCGG
ATGAGAGTGGAGAGGGTGAAGTCAGGGTTGGTGTTTTGGGAAAGGGGGAT
GAGTTAGGGAGGGTAGCTGCTGCTTTGCTTGATGATCCATTGGCTAGGGG
GGAGAGTGAAGATGGAGGAAGGCAGATGTGGGTAAAGGCGTTGCGGAAGT
GGTGTGCTGAGAGCGGGAGTAGGGGGCTGCTCATACGCCATGGCCCCTCT
AGCGAAATATCGACCCCAAAAAACTCACCCGTCTCCCTCCTCACCATTCC
GTCACCGCTTCTGAAACCCTCTAAACTCGAAATCCTGCTCGCACCAATAC
CCCCGGGAGACCCTACCGACCTAACTCTCCAGGCCAATAATGTTCCTGGC
TCACGTTTCATCAAATTCCCGGTTCATAAGTCGATAGTGTACGCAGGTGA
GGGAGAAGCTGGTCTACAAGTGCTCTTAGATCACGATTACACCACCACTA
CTGCTTACGATGATAAGTCACGGGTGCTCCGACTGCTCTCACTGCCGGAT
TTGGTCCCAGGGAAT

Sequences in the Contig:

SY0AAB44YN11FM1