Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB44YN09FM1
Length(NT) : 590
Best Gene Model Blast : Link to GSTUMT00008896001 E-value : 1e-104
Numbers of ESTs : 1

Blast Results:

Nr Definition: nuclear protein SNF4
Accession: ref|XP_001211154.1| Score: 227 E_value: 2e-17
KEGG Definition: hypothetical protein
Accession: yli:YALI0C03421g Score: 223 E_value: 3e-17
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG1764 Score: 167 E_value: 6e-13
PFAM Definition: CBS, CBS domain pair. CBS domains are small intracellular modules that pair together to form a stable globular domain. This family represents a pair of CBS domains, that has been termed a Bateman domain. CBS domains have been shown to bind ligands with an adenosyl group such as AMP, ATP and S-AdoMet. CBS domains are found attached to a wide range of other protein domains suggesting that CBS domains may play a regulatory role making proteins sensitive to adenosyl carrying ligands. The region containing the CBS domains in Cystathionine-beta synthase is involved in regulation by S-AdoMet. CBS domain pairs from AMPK bind AMP or ATP. The CBS domains from IMPDH and the chloride channel CLC2 bind ATP..
Pfam Number: pfam00571 Score: 114 E_value: 7e-07
Swissprot: Q9P869|SNF4_KLULA

Sequence:
>SY0AAB44YN09FM1
TTGGAAGAGACCTGATGATTTCTCTGGAATTCATACATGCTCCCCTCAGG
ATCGCTTGGACACGATATTTGATACTATCAGAAGGTCAAGAGTTCATCGA
TTCATGATTGTTGATTCGGGCGGTCGTCTCAAGGGTGTGCTTACTTTAAG
TGATATCTTACAGTACTTGCTGTTCGATGGGGAAGAGGAGTAATGGGGTG
TTGGATATTTTCTTGGCTATTTGGCCAAATTCATAGATGTTTGCCTAGAT
TGGGAATTGCGCCCGCAATCCCCACACCCACACTCTTTTTACCCATTGCT
GGAAGCGAGCCTATTTCTTGATTCTTTGTTGGTTCTCCCCTGGCTCTGCA
TGGGTTTCCTTTCCTTTCCTTTCCTCTCTAGGCGGAGGCGTTCAGGATAT
CGTGGATGAGCATGTATTTCCTTTCCCCTAGTTACTATTTCCATCTGCTT
TACTCATCTCCTGTTAAATACTACTTGCTATTTCGGTTCATGATGTTCCG
TCTGCGAGTCATATCGGCTACCTAATGTGGCCAAGGGGTAGGCGTGTATG
GGCGTGGCGAGCTAGGCTGGTGGAAGGTGGATGGGGACGT

Sequences in the Contig:

SY0AAB44YN09FM1