Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB44YK08FM1
Length(NT) : 391
Best Gene Model Blast : Link to GSTUMT00003253001 E-value : 1e-141
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG4764 Score: 194 E_value: 2e-16
PFAM Definition: DSS1_SEM1, DSS1/SEM1 family. This family contains the breast cancer tumour suppressor BRCA2-interacting protein DSS1 and its homologue SEM1, both of which are short acidic proteins. DSS1 has been shown to be a conserved component of the Rae1 mediated mRNA export pathway in Schizosaccharomyces pombe..
Pfam Number: pfam05160 Score: 184 E_value: 3e-15

Sequence:
>SY0AAB44YK08FM1
TTGGAACCATCAAAGACCACCGATCCCAAGGACTCTGCGGCTGATAAGCC
CAAGGAGCCACAGAAACAAGCATTATCGCTGGAGGAGGATGACGAGTTCG
AGGACTTTCCCGTCGAAGATTGGAAGGAGAGCGAAACTGATGTACAGAAT
CCTCCCGGTGGGAGATTGTGGGAGGAGAGTTGGGATGATGATGATACCAC
TGAGGACTTTTCTACCCAACTGAGGGAAGAGCTTAAAAAGAACCCCGCCA
AATAAATAATACACCTGCCGTTTCGATACAAGATTCACTCTCGTCGCTGG
TTAGAATTGGATGGGATGTTCTTTTTCGATTGTAGCATAGCTTCTCCAAC
GATCAAGGGACCCGTGGAGATCACGATGCCCGATGATAGTT

Sequences in the Contig:

SY0AAB44YK08FM1