Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB44YK03FM1
Length(NT) : 597
Best Gene Model Blast : Link to GSTUMT00007478001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_03102
Accession: ref|XP_001793686.1| Score: 425 E_value: 2e-40
KEGG Definition: GTPase activating protein Sar1, putative
Accession: afm:AFUA_3G09900 Score: 401 E_value: 7e-38
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG2128 Score: 141 E_value: 7e-10
PFAM Definition: No Hit Found
Swissprot: P33277|GAP1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0005099 = Molecular function: Ras GTPase activator activity
GO:0007265 = Biological process: Ras protein signal transduction
GO:0032005 = Biological process: signal transduction during conjugation with cellular fusion

Sequence:
>SY0AAB44YK03FM1
TCGCGTTTTTAATTTCTCCTCTGCCAGCGCCCGTTCGCTGCCGGTGTGAT
TGGTGAATCAGGGTCCCATTGTTATCTTTTCAGGTCGCATTCCTTCTTTT
TCTCCCCCGACCTTTTTTCACGACAACCAACTTTCTTTCGACAATAGTTA
GGGAAAAACAACAAGATCGTCTTTGTCCCATCTGGTTCGTTAAGCTGCAG
CGCAGGCTCTTTTCCACATGTCCGTCACAACAATGCTCGCCCCTTCGGCG
AGAAACTCGACATCGTCGACATCGTCTAGTTTCGTACCTGTCACTCGACA
GAATACTATTGGATCAGATGGCGCGCCTAGGTCGGTAAGAGCCTCGAAGA
GGTACTCCGTCACGGCGTTGTACCTCTCGATGTCGGCGCAGGATAAGGAT
ATGGAAATTGAGGATGAGCTTGCGAGAGTACAAAAAACACTTCGCGACTT
GAAGTCAAGGATTTCTTCGCAATCAAAAAAGAATTTCGTCCTAGAGAAGG
ATGTTCGGTATTTGGATTCACGGATAGCTTTGTTAATTCAGAATAGGATG
GCTTTGGAGGAGCAAAATGAGGTTGCAAGCCATTTCGATGAGTCGTC

Sequences in the Contig:

SY0AAB44YK03FM1