Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB44YK01FM1
Length(NT) : 677
Best Gene Model Blast : Link to GSTUMT00005495001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein NCU04241
Accession: ref|XP_961232.2| Score: 740 E_value: 9e-77
KEGG Definition: related to GTPase activating protein [MIPS]
Accession: ncr:NCU04241.1 Score: 740 E_value: 5e-77
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG1092 Score: 723 E_value: 3e-77
PFAM Definition: No Hit Found
Swissprot: O59737|GYP1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>SY0AAB44YK01FM1
TTGGAGATGGTGAGGTGGAAACCTTCGATCCAAGTTCTTTGCCAAAAGAG
GTTCTAGATGTGATTGAAGCAGATTCTTTCTGGTGTTTGACAAAATTGCT
CGATGGCATACAGGACAATTACATTCACACCCAGCCCGGGATTCAACGAC
AAGTCACAGCCTTGAGAGATCTGGTGCAGAGAATAGACGTGGGCTTAACC
AAACATCTCAGCGAGCAGGGAGTCGAGTTTATTCAGTTCAGTTTCCGCTG
GATGAATTGCATGTTAATGCGGGAGGTCAGTGTGAAGAACACAATACGGA
TGTGGGATACATATATGGCGGAAGGACAATCTGGGTTTTCGGAGTTTCAC
CTCTATGTTTGCGCAGCATTTCTGGTCAAATGGTCGGAACAGCTTCAGAA
GATGGATTTTCAGAACGTAATGATGTTCCTCCAATCTCTCCCAACACAAT
CCTGGGGCGAGAAGGAAATGGAAATCCTCCTCAGCGAAGCCTTCCTCTGG
CAATCCCTCTTCCGAAACTCCAGCGCCCACCTTCGCCAGCCAACTTCAAA
TGCATCTCTCCCAAGCATAACCTTATGATATACCCATGCACCTATCTTTC
TTTACCACGCCCATAAGAAAGGAAACCCCACCCCTTCTAATTCCCACATG
TACAATATTAGCAAAAACGAAAATACA

Sequences in the Contig:

SY0AAB44YK01FM1