Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB44YH19FM1
Length(NT) : 632
Best Gene Model Blast : Link to GSTUMT00007444001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_12206
Accession: ref|XP_001802432.1| Score: 461 E_value: 2e-44
KEGG Definition: hypothetical protein
Accession: mgr:MGG_03526 Score: 401 E_value: 8e-38
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG3350 Score: 401 E_value: 4e-40
PFAM Definition: No Hit Found
Swissprot: P53200|AML1_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0042802 = Molecular function: identical protein binding

Sequence:
>SY0AAB44YH19FM1
TTGGCTAGTATGGTGGAAGATGATACAGATGATGAACTCCACCACACAGA
CTCTCATCAGCTGCGCTCGAAGCATTGAACTCGTTTCTCGTGGAGAAAGA
TGAGCGACAGAAACGCTTTGAGGATCTGAAGGCCACGCTGGAGAAGGAGT
ATGAGGAAAGACAGAAGATTATTACCATGGAGGATTTTGAGGAGGATTGG
CAGCAGAGCCAGTTCTGGTATGATTCTGCTACAGCGGAGATGCTCGCGGA
GGAGATTCTTGATGGGGCTATAGAGGGGACGCTGGTCGGAATCGTCTCGG
CTCCGAGCGTCTTTGTGAAAATCCAAGAATTAAAGGCAGCAGAAAGGATA
CCGGACTCTATCAAAGTGCGCTTATTAGAATTCGATAAGCGCTTTGATTT
GTTTCCAGAGTTCATACACTACGATTTTCAGTATCCTCTCAGGTTGCCTT
CAGAACTGAAAGGAAAGTTCGATCGGATCTTAATTGACCCGCCTTTTCTA
AGCAATGACTGCCAAACCAAATCGGCTCTCACAGCTCGTTGGTTAATGAA
ACCGTGGGTAGCACCAACACGCGCCGCGAGCACATCTCACGACAGCGATG
GTCGCGACACTGCAGAGCAATCGCCCACACGC

Sequences in the Contig:

SY0AAB44YH19FM1