Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB44YH09FM1
Length(NT) : 582
Best Gene Model Blast : Link to GSTUMT00009049001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein DEHA0F19580g
Accession: ref|XP_461148.1| Score: 218 E_value: 2e-16
KEGG Definition: hypothetical protein
Accession: dha:DEHA0F19580g Score: 218 E_value: 1e-16
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: O60055|UTP20_SCHPO
Gene Ontology:
GO:0005730 = Cellular component: nucleolus

Sequence:
>SY0AAB44YH09FM1
TTGGGTCCACATCGCGCACAGAGCCTCCTCACACCTGAATTCCCCGGAGT
TAAGCGAGGAATTAGGCCTTCAGGTGGTGAAGAATTTACTATTCCTGACA
AGGTGCTTTCACGCCGCGGGGGTGGGGGCTATATCCTCCGTCCCCATGAA
TGATCCTGAACTCGACGACGTTGAGGAGGAGCAGCACCAGCAGGAAGAGG
GGAGGATAAGAAGGTCGGCGTTGGAATGGCTTGTGCAGAGAATCTCCGCA
ATCTTGCGTAGCGAACGGAACATCAAAAAGGGCCTCCTAGGGAAGAGATT
TGCCATGCAGTGGATTGCCGCGTTAATCCAACTCCTCCCGAAGGGAGATC
TCGAACCACTGGCGAAGACGCTGGTAAGGCCATTATATAATGTGCTAGAA
GTGGATGGTATGCACCTCATGAAAGACCTCAAACCAACAGCCCAAGAACT
CCAATCTTCCATCGCGGAAAAACTAGGCACAACTTTATTTGCTATCATCT
ATAGTCAAGTTAAGAGCGAAGCGCTCGAGAGGAGGAGGGTTAGGAAGGGG
AAGAGGGCGATTCTGGCTGTTACAGATCCGGA

Sequences in the Contig:

SY0AAB44YH09FM1