Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB44YE21FM1
Length(NT) : 670
Best Gene Model Blast : Link to GSTUMT00012110001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001555614.1| Score: 419 E_value: 1e-39
KEGG Definition: endosomal cargo receptor (Erv14), putative
Accession: afm:AFUA_6G07290 Score: 413 E_value: 4e-39
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones, Intracellular trafficking, secretion, and vesicular transport,
Kog Number: KOG2729 Score: 437 E_value: 4e-44
PFAM Definition: Cornichon, Cornichon protein..
Pfam Number: pfam03311 Score: 377 E_value: 3e-37
Swissprot: P53173|ERV14_YEAST
Gene Ontology:
GO:0005789 = Cellular component: endoplasmic reticulum membrane
GO:0030134 = Cellular component: ER to Golgi transport vesicle
GO:0007120 = Biological process: axial cellular bud site selection
GO:0006888 = Biological process: ER to Golgi vesicle-mediated transport
GO:0030437 = Biological process: ascospore formation

Sequence:
>SY0AAB44YE21FM1
TTGGCCGCCTCCTTTCCTCTTTCAACCTGGTGGATTGTTGCATCTTACGA
TCGGTTTGCCTTAATCTCTGCCTTTTCCCTTACTAACATCTTACCGATCA
CGCGCTTAATCAACGACGAAGCGATCAACGGCACAAAAAAATAATCGGAA
ATCATCATGTCCGGTGAGGCGTGGCTATACCTTCTAGCAGTATTATTAAA
TGCCGTCAACCTATTTCTTCAAGTTTTCTTCACCATAATGTTCGTATATA
TATATCAAGTACTCGGACCTCGAATGCGATTACATTAACCCCATCGATCT
TTGCAACCGCCTCAACACCTACATCGTTCCCGAAGCCGCTGTCCACGCTT
TCCTCACCGCTTTGTTTCTGGTCAATGGGTACTGGCTAGCGCTACTGCTC
AATCTACCGCTTGTGGTATTTAACGTTAAGAAGATTCTGGATAATGCTCA
TCTCCTGGATGCTACGGAGATCTTCCGAACACTGAACAAACACAAGAAGG
AATCTTTCATCAAACTTGGTTTTCATCTTGTCATGTTCTTCTTCTACCTA
TACAGTATGATTGTTGCTCTTATCAGAGATGAGACCAACTAGGTTGAACG
AGAAGCATTTACTCAGACTGTGTGGGACACGTTTCAACGGAGCTGAAATG
GATGGACTGCTGGAGCATTA

Sequences in the Contig:

SY0AAB44YE21FM1