Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB44YD18FM1
Length(NT) : 617
Best Gene Model Blast : Link to GSTUMT00000359001 E-value : 1e-173
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An02g06840
Accession: ref|XP_001399819.1| Score: 170 E_value: 9e-11
KEGG Definition: hypothetical protein
Accession: ang:An02g06840 Score: 170 E_value: 5e-11
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB44YD18FM1
TTGGGTCGTTGTCCTTAGGAGAAAATTAGAGGAGTATTTGGAGGATGGTA
GAACGAGAGAGACTTTAGTCGCAGCAGTACAGGAACATGTTATCCAAGCT
TATGAGTCGTACTATGAAGAGATATTTCTTAGGGACGATAGTGTTCCACC
TAGATCTCCCGGAGGTACGGTTTGGGACGTTGAAGTGTTCGTGGGATGGA
GTAACGATATCTTTGCGGTTGGGCATGGCTTTTTGGCATACGATGGCGAT
GGTGCCGGGAGTGAGGATATGAGCCCGGGAATGTCAAGAGCAGGAAGTTT
GTGTACGTAATTGCGGATAGTGCAGATGGGATGCCAAGTCAGAGTGTATC
TCACTAATTCTCGAGGGGTCAGTGGTTGGTTGTTTGGAGGTTGGGATACC
TGATATTGTTAAGTTTGTCCGAGTGATGGATGTTAGAGGTATGGAAGATT
GACGGGTATTTTGACACTCCCCAGTGGTAACTATTTCCCTGGAGCTACAC
TGCCCCGATTCATCTGCCGAGGAATCTCGTTGAATGGTTGCAAGATGCTT
GGGGTATCATATCGGTAGTTCTCCATCACCAGATGCTTATCTAATCCACC
AAAACTCACGTCAATTA

Sequences in the Contig:

SY0AAB44YD18FM1