Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB44YD01FM1
Length(NT) : 446
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein NCU09539
Accession: ref|XP_958758.1| Score: 293 E_value: 3e-25
KEGG Definition: hypothetical protein
Accession: ncr:NCU09539.1 Score: 293 E_value: 1e-25
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG3311 Score: 163 E_value: 9e-13
PFAM Definition: Ribosomal_S13, Ribosomal protein S13/S18. This family includes ribosomal protein S13 from prokaryotes and S18 from eukaryotes..
Pfam Number: pfam00416 Score: 217 E_value: 5e-19
Swissprot: O59772|SWS2_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005739 = Cellular component: mitochondrion
GO:0005634 = Cellular component: nucleus

Sequence:
>SY0AAB44YD01FM1
TTGGCAACTTGTTCATAAAGCTCTCAGATCATTTTTTGGCATCGGCCGCA
ACGTTGCCGACCGAATCTGCGCAAAGTTCTCGATTCACAAAACTGCCAGA
ATATCCCAATTGACGCAACCGAAGGTCACGGCGATAACATCAGAAATGAC
GAAAATGGTTATAGACACGGAATTAAGGAGGAATATAGCGGATAATGTGA
TACGATTGAAGGGTATTGGGACATATAGAGGGAAACGGCACGCTCAGGGA
CTCCCAGTCCGAGGGCAAAAGACGAAGAAGCAAATTGTCAACGCGCGGAA
ATTTAACAGGCTACAGACTAATATATGATAAAATGGTGGTGGTGGTCATA
TTTATGGTGGGTGTGTGGAAGCTGTGGGAACGTATGATAATATGTGTAAA
CATGGCGTCCGCGTGTTCATAGATCCAGCTGAAATAGTATATCTTC

Sequences in the Contig:

SY0AAB44YD01FM1