Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB44YB05FM1
Length(NT) : 607
Best Gene Model Blast : Link to GSTUMT00002450001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An07g09920
Accession: ref|XP_001392067.1| Score: 926 E_value: 2e-98
KEGG Definition: hypothetical protein
Accession: ang:An07g09920 Score: 926 E_value: 1e-98
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG0399 Score: 824 E_value: 4e-89
PFAM Definition: Pyr_redox_2, Pyridine nucleotide-disulphide oxidoreductase. This family includes both class I and class II oxidoreductases and also NADH oxidases and peroxidases. This domain is actually a small NADH binding domain within a larger FAD binding domain..
Pfam Number: pfam07992 Score: 163 E_value: 2e-12
Swissprot: Q9C102|GLT1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>SY0AAB44YB05FM1
TTGGCTTTCCTCCATGCCAATACCAAGTCTTTGCTCGACTCAACCCATGA
GGATGGCAAATATATCAGTGCAAAGGGCAAGGATGTCATCGTTATCGGTG
GAGGTGATACCGGTAACGACTGTATTGGTACCGCTGTTCGTCACGGTGCA
AAGTCAGTTGTCAACTTCGAGTTACTTCCTCAACCACCGAACGAGAGAGC
CAGGGACAACCCTTGGCCGCAATGGCCTAAGGTGTACAGAATTGACTATG
GCCACTCAGAGGTTAAGGCACGATATGGAAAGGATCCTAGAGAATACTGT
GTCATGAGCAAGGAGTTTGTAAGTGATGGCGGCGGCAAGGTCAAGGGTAT
CAACACAGTCCGTGTGGAGTGGGCCAGGAGCTCTCGCGGGGGTTGGGACA
TGAAGCAAGTCGAAGGATCCGAACAGTTCTTCCCTGCAGATCTTGTGCTC
CTCTCAATGGGTTTCTTGGGCCCGGAGGACAGAGTATTGGGTGATATCGA
GAGAGACGCTCGGAAGAATGTCAAGACACCCCCGGGAGCCTACTCTACTT
CCATGCCTGGTGTCTTTGCCGCTGGTGATTGCCGAAGAGGACAAAGCTTA
ATTGTCT

Sequences in the Contig:

SY0AAB44YB05FM1