Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB44YA07FM1
Length(NT) : 309
Best Gene Model Blast : Link to GSTUMT00007062001 E-value : 3e-96
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q0U6W8|SSN2_PHANO

Sequence:
>SY0AAB44YA07FM1
GCGGCGTATGTGCGGGAGCACGACTCCCCAGGTTTCGTCGCAGACATCGA
CCAGGTAAGAGTCAGGGTCTAGGTCCGGTGTCGGGTCAGCAGAAGGTGTG
TTCGCTGCGTTGCCAAACTGGTCGGGAGAGACGATGGAGCCTGGCGTTGG
GGTCGTGACGGGTGGGGTAGTGTATACTGAAACCTGGTGGTTGAAAGCTG
TTGGTATGGGCGCGGGTAATGACGGGATTAGGTATACTGGCGGATTCAAG
TCTGCAGAGAGGATTGCGAGTGAGTGTGTAGTAGTTGAGGCGAGGGTTGT
CCAGGTACT

Sequences in the Contig:

SY0AAB44YA07FM1