Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB43YP15FM1
Length(NT) : 471
Best Gene Model Blast : Link to GSTUMT00009628001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE65833.1| Score: 312 E_value: 2e-27
KEGG Definition: putative Zn2+ transporter MSC2 (cation diffusion facilitator superfamily)
Accession: aor:AO090103000402 Score: 312 E_value: 8e-28
KOG Definition:
Classification: [Inorganic ion transport and metabolism].
Kog Number: KOG1484 Score: 207 E_value: 9e-18
PFAM Definition: Cation_efflux, Cation efflux family. Members of this family are integral membrane proteins, that are found to increase tolerance to divalent metal ions such as cadmium, zinc, and cobalt. These proteins are thought to be efflux pumps that remove these ions from cells..
Pfam Number: pfam01545 Score: 131 E_value: 6e-09
Swissprot: Q8TAD4|ZNT5_HUMAN
Gene Ontology:
GO:0016324 = Cellular component: apical plasma membrane
GO:0005794 = Cellular component: Golgi apparatus
GO:0005887 = Cellular component: integral to plasma membrane
GO:0005624 = Cellular component: membrane fraction
GO:0030141 = Cellular component: secretory granule
GO:0008270 = Molecular function: zinc ion binding
GO:0005385 = Molecular function: zinc ion transmembrane transporter activity
GO:0006882 = Biological process: cellular zinc ion homeostasis
GO:0006824 = Biological process: cobalt ion transport
GO:0010155 = Biological process: regulation of proton transport
GO:0010043 = Biological process: response to zinc ion
GO:0006829 = Biological process: zinc ion transport

Sequence:
>SY0AAB43YP15FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCATGGTGCCCGTATCATAAC
ACTGCAACCGCAGCTTACCCCGACAAATACACCCAATCACGAAGTTACTG
TATACCATCCTCTTGTTCGATGGCAGCAATTCAAATCGATAGGGTAGCCC
ATGACCATCGCCATCGCCACCATCACGATTATGCACACGAGCACGGAAGT
AGCCATGCGCATCCAAAGGGGATCAAAAGTCCTTCAAGTATCACAAAAGC
TCTACTAAAGATGACGGAGGGGGTTCCTTTGGTTCACAGTATACTGATTG
AGAAGGACTCGCGGAGGATTGGATACTTTATGTGTTTGAATTTCGCGTTC
ATGATCGTTCAAACGTGTTACGGCTTTATGACCGGGTCTTTGGGCCTTAT
ATCTGATAGTGTACATATGTTTTTTGATTGCCTGGCCCTTGCGATAGGAC
TTTGCGCAGCCGTCATGAGCA

Sequences in the Contig:

SY0AAB43YP15FM1