Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB43YM22FM1
Length(NT) : 568
Best Gene Model Blast : Link to GSTUMT00012124001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Transcription].
Kog Number: KOG0260 Score: 127 E_value: 2e-08
PFAM Definition: No Hit Found

Sequence:
>SY0AAB43YM22FM1
TTGGCCCCAGCACGCCCTTCCCGGAAGGCCAATTCCTAACAATCGCTGGC
CTACTCACTGCCCTCAAGCAAAAACTCACAACCCTCCAAACCGCCCCCTC
CTCCCCGGAAGCGGAAGATGAACTCGCGAGCGACATCCTAGCCACGGCAA
CGCACGCCTACCGCCGCATCCGGCGTAGGCTCCTCTCGCAGGAGCGGCGC
GATCTGGAATTCCTCGCTCACGCCACTCTCGCCGAGAGCAACTCGGAGTT
TCGCCGTCGCCGGGGGGAGCGCAACGAGCGTGCGCGTGAGCGTCGCAAGA
CACGGGATTGGGTGCGCGCCGTGGGGTACTATGCCCATGCGGTGCTTCTG
AGCGGGGAGGTTGATGATGAGGACTTCGAAGAATTGGAGTATACACGCGA
TGTCGGGTATCGGGTTTTCAAGCTGGCTTGTGGGGTTGCTGCTGGGGGGA
GGGACGGGGGAGTGGAAGTTATTAGGGGGGAGCAAGGGGTAGGGTTCGGG
TTTGGTGATGGTGATGGCGATGGTGACGTGGACGGGGACGAGGAAGAAAT
GTTGAGGGAATACTTCAC

Sequences in the Contig:

SY0AAB43YM22FM1