Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB43YM17FM1
Length(NT) : 607
Best Gene Model Blast : Link to GSTUMT00002754001 E-value : 1e-114
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE57037.1| Score: 104 E_value: 2e-08
KEGG Definition: ankyrin repeat
Accession: aor:AO090001000528 Score: 104 E_value: 9e-09
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB43YM17FM1
TTGGCGGGGATCCTATTTCGACTGCCACGGCGTGACATAGTTCATGGGTC
TTTAACGGACGTTCAGAGTGAGAGATCCACATTAGAGCCGCAATTCCGAG
CCTCGATCTCTCCTCACCCTGTGCCTTTATCCGATCCAATGTTGCACCAT
AAACATCGCCTAGCCCTATGCCGTCAGTCATTGCTCTCAACTTTTGTCGC
CTGCGACTGATTGTGGGTTCCTGCAGAATCACATCGATATTCAACGCGAC
GAGTAAGAATCTAAATAGATACCTATTAGTGAATGACGCAGGGTCGGTCC
CCCACTATCGCAGCTTCTACACACATTTCCGAAAGATACTCCCCAATTTT
CTTAAGGATGTCTGCCTTCAGACCACCGTCCATCGCATCCGGGGTTGTGT
CCTCGCGTAGCTTGGTCCGAAGATAGCTCTCAATATCGCCTCCTCTGGGA
GTGATGAATACGCTCCTCAGCATTCCAGCAAGACGCCTTCCCATCTCAGG
CCCAACTTGTGGTCTCCCAGTCACGAAAATTCGCGTACCCGGAGAGTTTT
GGAGAACCGATTTCAGTGAGTCAAGGAGTTTCGCTAAATGCCCTGTCACA
CATTCAT

Sequences in the Contig:

SY0AAB43YM17FM1