Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB43YL02FM1
Length(NT) : 538
Best Gene Model Blast : Link to GSTUMT00011972001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_03661
Accession: ref|XP_001794215.1| Score: 622 E_value: 3e-63
KEGG Definition: translation initiation factor, putative
Accession: afm:AFUA_4G05830 Score: 593 E_value: 3e-60
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG1468 Score: 652 E_value: 3e-69
PFAM Definition: IF-2B, Initiation factor 2 subunit family. This family includes initiation factor 2B alpha, beta and delta subunits from eukaryotes, initiation factor 2B subunits 1 and 2 from archaebacteria and some proteins of unknown function from prokaryotes. Initiation factor 2 binds to Met-tRNA, GTP and the small ribosomal subunit. Members of this family have also been characterised as 5-methylthioribose- 1-phosphate isomerases, an enzyme of the methionine salvage pathway. The crystal structure of Ypr118w, a non-essential, low-copy number gene product from Saccharomyces cerevisiae, reveals a dimeric protein with two domains and a putative active site cleft..
Pfam Number: pfam01008 Score: 425 E_value: 6e-43
Swissprot: Q9BV20|EI2BL_HUMAN
Gene Ontology:
GO:0042802 = Molecular function: identical protein binding

Sequence:
>SY0AAB43YL02FM1
TTGGGCGACGGCTGGCTACGGCACTGCGTTGGGCATCATCCGCTCGCTGA
ACTCTCGTTCGAACCTGACGCACATTTACTGCACTGAGACCCGTCCTTAC
AACCAAGGCTCCCGATTGACGGCGTTCGAACTCGTTCACGATAAGATACC
GGCAACATTGATTACAGACTCGATGGCATCCTCCCTCATGAGCCTCAAAT
CTATAGCGGCCGTTATCGTGGGTGCGGACCGTGTAGCTGCCAATGGTGAC
ACAGCCAACAAAATTGGTACCTATCAGTTAGCAATTGTTGCCAAATATCA
CGGTGTCAAGTTTGTTGTGGCTGCGCCGACTACGAGCATCGATATGAAAA
CAGCTTCGGGCAAGGATATTGTCATCGAGCATAGGCCTGGAAAGGAAGTA
ACGGTCATTCGTGGTCCACTAGTGAAGAACGACACGGTTGGCATGGAGGT
GGATTTGGAGAACGTGGAGACAGTGGCCACGGCAGCTAGGGGTATCAATG
TCTATAACCCTAGCTTTGATGTGACTCCGAAAGGCTTG

Sequences in the Contig:

SY0AAB43YL02FM1