Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB43YG04FM1
Length(NT) : 518
Best Gene Model Blast : Link to GSTUMT00000935001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE64082.1| Score: 321 E_value: 2e-28
KEGG Definition: Zn2+-binding protein Melusin/RAR1, contains CHORD domain
Accession: aor:AO090038000270 Score: 321 E_value: 9e-29
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG1667 Score: 230 E_value: 2e-20
PFAM Definition: CHORD, CHORD. CHORD represents a Zn binding domain. Silencing of the C. elegans CHORD-containing gene results in semisterility and embryo lethality, suggesting an essential function of the wild-type gene in nematode development..
Pfam Number: pfam04968 Score: 248 E_value: 2e-22
Swissprot: Q9R000|ITBP2_MOUSE
Gene Ontology:
GO:0030018 = Cellular component: Z disc
GO:0005509 = Molecular function: calcium ion binding
GO:0008270 = Molecular function: zinc ion binding

Sequence:
>SY0AAB43YG04FM1
TTGGCACCTTCCCATCCTCTAACTCCCCTATTGTCCACTACCGGGGCAAA
AAAAAAAAAAAAAAAAAAAAGCGGATACCAACTCTAGCACAACCCTTTAT
TTCCCCTCCCGTTATACTTCCAAACCATTGCAAATTGAAAGATATTGAAA
ATGACGCAGAAGTGTGCCCACAAAGGCTGTGGAAAGACATTCACGGATCC
GGAGGAAGAATGCCACTACCACCCAGGAGCGCCCATATTCCATGAAGGCC
AGAAAGGCTGGCAGTGCTGCAAAACAAGAGTTCTCACCTTCGACGAGTTC
CTCACAATCCCGCCATGTTCAGTCGGCAAGCACTCCGTCGACGCACCTAT
CTTAGCACCCGTACAAACATCCGGACCCGGATCACAACAGCAAAAACACC
CCGAAGTCGCGCCTCCACCGGAGATTGGCTCGGACGGAACAGAAGTATAC
GGCCAACCACAGCCATTGCAGAGGAAGGCGCTCCCGAAAGTGGGTGCAGC
ATCGGGCACTCCTCCGCC

Sequences in the Contig:

SY0AAB43YG04FM1