Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB43YF10FM1
Length(NT) : 595
Best Gene Model Blast : Link to GSTUMT00004929001 E-value : 1e-159
Numbers of ESTs : 1

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001218532.1| Score: 275 E_value: 6e-23
KEGG Definition: hypothetical protein
Accession: ani:AN8541.2 Score: 220 E_value: 7e-17
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG1840 Score: 123 E_value: 7e-08
PFAM Definition: No Hit Found
Swissprot: P37285|KLC1_RAT
Gene Ontology:
GO:0005624 = Cellular component: membrane fraction
GO:0005515 = Molecular function: protein binding

Sequence:
>SY0AAB43YF10FM1
TTGGAACGAGAACAGAAGAAAGCTGGCGCAAGGAAAAGAACGATAAAGCG
GGCAGAACAAGACGATAGGCAGATTAGGTATATGAATAGAGATCAGCGCT
TTTATAGGAGTACCTCCCAACGGTGCCGGAGAGCTACAGTATTTTAGCGA
TACGAACCAACAGTGACCTGAAAGTGGACGAGAAAACTCGCTTTCGCTAG
GACGAGTTCAGGTCGAGCCCGCTGTTCGGTTAATCCTAGCAATAGAGCGG
CAACTGGGGCCTTAACACCTACATAGCCAAGTAGCTCCACGGATTTACGA
TAGAATAGAAGTTATGCATCGGCGTGCATTGGCAGTCGGAAAGAGGTTTC
TGGGGAGAGATCATCCGGATACCTTATGGAGCGTCAGTGAACTAGGAAGC
ACACTGAATACAGAGGGAAAGCTCAACGAAGCGGAGATTATCTATCGACA
TGCATTGACAGATGGAGAAGAGGCGCTTGGGGGAGAGCATCTGGATAGCT
TATTTAGTGTTAATGAGCTGGGTGTGGAGTTGTATCAACAGGGAAAATAC
GACGAAGCGGAGAGAATGCATCGACGTACTTTGGAGGGTAGAGAG

Sequences in the Contig:

SY0AAB43YF10FM1