Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB43YF02FM1
Length(NT) : 516
Best Gene Model Blast : Link to GSTUMT00004884001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CC1G_10917
Accession: gb|EAU85645.1| Score: 199 E_value: 3e-14
KEGG Definition: LOC797764; similar to transposase (putative)
Accession: dre:797764 Score: 154 E_value: 2e-09
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB43YF02FM1
TTGGCTCTGATGGTATGGGGAGCCATCAGTTATAATTGGAAGTCACCGCT
GGTCTTTCTCGAAGGTACAGGAAAGAAAGGTGTTGTTGCAGAAGACTATC
TTCATCATATCCTCGAACCTGTTGTTGCGCCTGCCTACATGGACCTCCTT
GGCTACGATGCATCCCCCGAAGCCCAATATATCGAAGACCAGACCTCAAT
CCATGGGACCCAAAGGCTGCTTATAGAGTCTAAAAAGATGTTAGGCATTC
CACTCCATCCTCGACCGGCATCATCACTGGACCTTAACCAAATCGAAAAT
GTGTGGAGGATATTGAAGCAAAGAATTAAGGGGAGGGATACCTTCCCTAA
AACCATCTCTCAGATGAGAAAGGCGGTTCAGGAGGAGTGGGATTGTTTAC
AACCTCATGATTGGAATCGGTATATTGACAGCATGCCTGTGAGACTTGTT
CAAGTCAAACAGCGAAAAGGGATGCAAACTGAATTTTAATGTATTTTATT
AGTTCAGAAAAAAAAA

Sequences in the Contig:

SY0AAB43YF02FM1