Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB43YE18FM1
Length(NT) : 545
Best Gene Model Blast : Link to GSTUMT00010297001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_05654
Accession: ref|XP_001796052.1| Score: 176 E_value: 1e-11
KEGG Definition: hypothetical protein
Accession: ani:AN1952.2 Score: 171 E_value: 3e-11
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB43YE18FM1
TTGGCTAAAAACCCTCCTCCTCTTCCTCACAATTCTTCTCGACCGGCGTC
GGCGGCGCCGGGAACATGAGGCACAAATCCGAGCGCGCCATTTTCTTCTT
CGACGAGGAACTGGAGAGGGAGAAGGTTATACGCGAGAACCGTGCGCCGG
TCTACTCCATCGGTCGGGGGGGCGCTGGAAATATAGTCTCTGCGGAATCA
CCGATGAGGACCGGGTCGGATTACTCCATGGACTCGCTATTGTCGGCAAA
GAGCTCTATTCAGCCGGAGATAGTAGCTGTGGAGGCCCCGGAAGAGGGGA
AAGCTGTTCTAAAGTCTGGAGCTGATAGGGCATGGAATAGGGTTCGGGGG
TTTCTCGGTCGGAGGGTGTTGTAAATCTCCTTGCTTTAAGATTTATTCTT
TGTATAGATTTCTTTTTTTTTCTTTCTTTCTTCTAATATCGTATGTGCCC
TTTATCTCCTTATTCTCTTTCTTTTTTTTCCCTATGGGTTTCCGGACGAA
TATATGGGGTTTGGTATTGTGACTTGGAATTGGAGTTTTGGTCTT

Sequences in the Contig:

SY0AAB43YE18FM1