Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB43YE02FM1
Length(NT) : 658
Best Gene Model Blast : Link to GSTUMT00001434001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein HCAG_09326
Accession: ref|XP_001535757.1| Score: 719 E_value: 2e-74
KEGG Definition: hypothetical protein
Accession: ani:AN2877.2 Score: 680 E_value: 4e-70
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG2210 Score: 405 E_value: 2e-40
PFAM Definition: Oxysterol_BP, Oxysterol-binding protein..
Pfam Number: pfam01237 Score: 352 E_value: 2e-34
Swissprot: O74178|KES1_SCHPO
Gene Ontology:
GO:0000935 = Cellular component: barrier septum

Sequence:
>SY0AAB43YE02FM1
TGTACAAAAAGTTGGCATTTCTCTCTTTACAATTGATCCCACCATTCCCA
ACGGAAGACAAATAGCTTTATCAACAAACCACCACAAACATGAGCTCGTC
CAAGGAAGAAGGGGGTGCAGTTCCCGCTGCTGCTAAGAGCTCCTGGGGCC
CATTCCTGAAGTCCATCGCGTCATTCACTGGGGATCTAGCGAGTCTAACA
GCTCCACCATTTATATTGAGCTCTACCAGTTTAACTGAGTATTCGGGTTA
TTGGGCTGAACATCCTGAGATATTTGTTGCGCCAGCTCAAGAGAAAGACC
CGCAGAAGAGAGCTCTTTTGGTGCTCAAGTGGTTCCTGACCACACTCAAG
CAGCAGTATAGCTCAAGAAACGAGAAGCTCGGTTCGGAGAAGAAGCCACT
CAACCCCTTTCTGGGGGAACTGTTCCTCGGAAAATGGGAAGATCCCACCG
GAAAAATTGGAGAGACTCAATTGATATCCGAGCAAGTTAGCCACCATCCT
CCTGTTACTGCCTATGCCATCTTGAACCAGAAACAAGGCGTCAAGCTTGA
AGGCTACAACGGCCAGAAGGCTTCTTTCTCGAGAGGTACCATTTCAGTAA
GGCAGGTTGGGCACGCCAAGTATCACTTGAAGAAATTTGATGAGGACTAT
CTGATTAC

Sequences in the Contig:

SY0AAB43YE02FM1