Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB43YD03FM1
Length(NT) : 579
Best Gene Model Blast : Link to GSTUMT00010683001 E-value : 9e-64
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_12915
Accession: ref|XP_001803132.1| Score: 204 E_value: 5e-25
KEGG Definition: hypothetical protein [EC:6.3.4.2]; K01937 CTP synthase
Accession: spo:SPAC10F6.03c Score: 259 E_value: 2e-21
KOG Definition:
Classification: [Nucleotide transport and metabolism].
Kog Number: KOG2387 Score: 273 E_value: 3e-25
PFAM Definition: CTP_synth_N, CTP synthase N-terminus. This family consists of the N-terminal region of the CTP synthase protein (EC:6.3.4.2). This family is found in conjunction with pfam00117 located in the C-terminal region of the protein. CTP synthase catalyses the synthesis of CTP from UTP by amination of the pyrimidine ring at the 4-position..
Pfam Number: pfam06418 Score: 223 E_value: 2e-19
Swissprot: O42644|PYRG_SCHPO
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm

Sequence:
>SY0AAB43YD03FM1
TTGGCAACGACAAACTGGGTCTTGTCTCTCTTTTCCTTCCTTTCCTTTTG
AGAAAATTCTTACCAAATTTGAAACGAAGGTTGGAAAGATGAAGTACGTA
CTAGTTTCTGGAGGTTAGCATTTTATTCTCCCTCCCATACTTTCGGGTTC
GGTAATGGGAGACTGATTGTGGCGATCGAGTTCTAGGTGTGATTAGTGGG
ATTGGGAAGGGCGTTATTGCCTCTTCGACGGGTCTATTGTTGAAGACCAT
TGGTCTTAAGATTTGTCTCCTCACTCCAGGTTTTATTGTATCCCTCTCGC
TAAACCGTAGCTTTACGTCTCGGCCATTAAGATCGATCCGTACATGAATG
TCGATGCAGGAACTATGGCTCCCACCGAGTATGTTTCTCCCTCCTTTTTC
TCTCGAGAGTCGGGGAGTTGGGGAGTCATTCGTTGGTTGCTGATTGGCAG
CGGTCAGACACGGTGAGGTGTTTGTCCTCAATGATGGTGGTGAAGTCGAC
CTGGACCTTGGCAATTACGAGAGGTACCTTAATATCACGCTTACTCGGGA
GAATAATATCACTACCGGAAAGATTTATC

Sequences in the Contig:

SY0AAB43YD03FM1