Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB43YC21FM1
Length(NT) : 590
Best Gene Model Blast : Link to GSTUMT00004394001 E-value : 8e-55
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein
Accession: ref|XP_499707.1| Score: 158 E_value: 2e-18
KEGG Definition: hypothetical protein
Accession: yli:YALI0A02871g Score: 158 E_value: 1e-18
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG3493 Score: 168 E_value: 5e-13
PFAM Definition: No Hit Found
Swissprot: O94650|HUB1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0005515 = Molecular function: protein binding
GO:0000398 = Biological process: nuclear mRNA splicing, via spliceosome
GO:0008104 = Biological process: protein localization

Sequence:
>SY0AAB43YC21FM1
TTGGAGCAAATATCCCCCCACCAATCCGAGGATCCAACGAACAAACCAGC
GAGCAAGCAAACAAAAACATGTTATCCCACCGGCTCAACTGTAATACCTA
CGCACCCCATCAGCACAGAGCCTAACCCAAAACCCAAGTTTGGAAAGAAA
AACCTACATCTCCAAAGAAGTCCCATTGCTAATCTCGTAATCGGCCAGGG
TGATGTGATCCTTAAACGTGTTGTACCACTTCTTGAGCACAATCTGGTCA
ACCTCGTCAGCACTCCCCTCTATGATACTTCCTTCCTTCCTGGTGGGAGC
AGACATACCTTCTCCGCCGAAGTCCCTATCTGCGCCGCCACCAACCTTTT
AAAGTCACCGATCGTATCATTCGGTTCGCATTTTACGCGCACTTTTTTGC
CGAGGCGGTCGTTGCTGGTTTGTGTTAGCCTGTTTGTTTGTTCTGGAAGT
TAGATGGGAGAAAGGGGAGGTATCATACCAGATTACTTCGATCATGGTGA
GTTGTTGGGGATTTCCTTCGTGGTTGTGAGGTGGATGGGAGGTTGTGATG
GGTTGGGAATGGCGGGGTGACGGATGACACATGCGGCTCA

Sequences in the Contig:

SY0AAB43YC21FM1