Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB43YA03FM1
Length(NT) : 575
Best Gene Model Blast : Link to GSTUMT00006257001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein
Accession: ref|XP_504762.1| Score: 761 E_value: 2e-79
KEGG Definition: hypothetical protein
Accession: yli:YALI0E34170g Score: 761 E_value: 1e-79
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG0678 Score: 753 E_value: 6e-81
PFAM Definition: Actin, Actin..
Pfam Number: pfam00022 Score: 435 E_value: 4e-44
Swissprot: P32390|ARP3_SCHPO
Gene Ontology:
GO:0030479 = Cellular component: actin cortical patch
GO:0005829 = Cellular component: cytosol
GO:0005515 = Molecular function: protein binding
GO:0000915 = Biological process: cytokinesis, contractile ring formation
GO:0007163 = Biological process: establishment and/or maintenance of cell polarity
GO:0030833 = Biological process: regulation of actin filament polymerization

Sequence:
>SY0AAB43YA03FM1
TTGGGACAATTGGGACCATATGGAGCGCTTTTGGCAGAATTCGATTTTCA
AATATCTTCGAGTTGAGCCGGAAGACCACTATTTCCTTCTAACCGAACCT
GTGATTATCACCCTAGAGTGTTCTGTTTGAGCTGTGAACTGACCCAGGCC
TTGAAAGCCTCTAAATCCTCCAGAATCCCGTGAAAACACCGCCGAGATCA
TGTTCGAGACCTTCAATTGCGCCGGATTATATATTGCCGTGCAAGCGGTA
CTGGCATTGGCTGCAAGTTGGACAAGTAGCAAGGTTCAGGACCGGAGCTT
GACTGGTACTGTTGTTGACTCAGGAGATGGTGTTACACACGTTATTCCAG
TTGCTGAAGGTTACGTCATTGGATCATCGATCAAGTCCATCCCTATCGCC
GGGCGCGACATCACATTCTTTGTTCAGTCGCTCCTTCGTGACCGAAACGA
GCCTGACTCCTCTTTGAAGACCGCTGAGCAAATTAAGGAGGAATTCTGTT
ACGTCTGTCCAGATATTGTGAAGGAGTTCACAAGATTTGACCGAGAGCCA
GAGAGGTTTCAAAAATATGTTGCTG

Sequences in the Contig:

SY0AAB43YA03FM1