Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB42YN09FM1
Length(NT) : 583
Best Gene Model Blast : Link to GSTUMT00000571001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An16g03950
Accession: ref|XP_001397706.1| Score: 507 E_value: 7e-50
KEGG Definition: hypothetical protein
Accession: ang:An16g03950 Score: 507 E_value: 3e-50
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2820 Score: 277 E_value: 9e-26
PFAM Definition: DAO, FAD dependent oxidoreductase. This family includes various FAD dependent oxidoreductases: Glycerol-3-phosphate dehydrogenase EC:1.1.99.5, Sarcosine oxidase beta subunit EC:1.5.3.1, D-alanine oxidase EC:1.4.99.1, D-aspartate oxidase EC:1.4.3.1..
Pfam Number: pfam01266 Score: 136 E_value: 2e-09
Swissprot: P23342|MSOX_BACSN
Gene Ontology:
GO:0008115 = Molecular function: sarcosine oxidase activity

Sequence:
>SY0AAB42YN09FM1
TTGGGTCCGGTTTTTAATAGCGGAGGTGTCGGGACTCCTCTACTCAGGGC
GTAGGGTCCTCGGCGTCAAACTTCTCGACGGGAAAGAGGTCACCGCGGGA
CTTACTATTCTCGCTGCCGGTGCATGGACACCCGGCCTCGTTCCATTACA
TGGCCGGGCGGTCCCGTCGGGGCAAGTCATAGCCTATCTAACCTTATCCA
GAGAAGAAGCGATCCGCTACGCAAGTCTGCCCGTACTCCTAAACCTCACG
ACAGGAACATTAATAATCCACTCCCCAAGCACCTCGCCCCCAACCCTAAA
GTTCGCCCGGCACGCACAGGGATACGCTTCCCCCACGCCGGTATTCCCAA
AGGCCATTCCACAGGAGGGTGAAGGTGCGCTGAGGGATGCGGTCAAACAG
CTAGTGCCCGAGTTCTCCGAGAGACCGTTCGAGAAGACTAGGGTGTGTTG
GTATACTGACACCCCTGATGGCGACTTTTTGGTGACCTGGCATCCGGAAT
ATGAGGGGCTGTTCATTGCTAGTGGGGGAAGTGGGCATGCGTTCAAGTTT
TTGCCAGTGCTGGGGGGTGAGATTGTGGATGTG

Sequences in the Contig:

SY0AAB42YN09FM1