Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB42YL20FM1
Length(NT) : 473
Best Gene Model Blast : Link to GSTUMT00005259001 E-value : 1e-120
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_07043
Accession: ref|XP_001591597.1| Score: 181 E_value: 2e-12
KEGG Definition: hypothetical protein
Accession: ncr:NCU01070.1 Score: 141 E_value: 5e-08
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB42YL20FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACAAAG
TTGTCCCCCGCTGGCAGAGCTCCAGCCAATATCGTCAGGATGAATAAATA
CACGTTTTTACCTATCCTCCGCTCTTCGGCCAATCCTTCGAGAACGAGCC
TTTTCACTATCGCACGGTGTTGTCAGTCGAAAACACATTCTGCTACGCAT
GCCACGGCTCCAAGCAAATATAGTGGTATTCGAACATTCACCACAACGCA
GTGCCTAATGGCGCAACGGAGGATCCTAGTCTGCTCAATCGGCAACCCAG
GACAATACCTAAACACCCGCCACAGTGCCGGCCACACGCTATCAAACCTC
CTCCAAGGGACACTCGCCTTCCCACCGTTCAGGAAAAGTGCTAGCTACGG
TGGCAACGTCTCCATGGGCGGGTTTGACAGCACGTACACGCTCTTCCAGT
CACCATCGCTCATGAACGTCTCA

Sequences in the Contig:

SY0AAB42YL20FM1