Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB42YH19FM1
Length(NT) : 556
Best Gene Model Blast : Link to GSTUMT00000554001 E-value : 3e-85
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_13577
Accession: ref|XP_001803784.1| Score: 148 E_value: 3e-08
KEGG Definition: TPR Domain containing protein
Accession: tet:TTHERM_00836620 Score: 134 E_value: 5e-07
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0553 Score: 136 E_value: 2e-09
PFAM Definition: No Hit Found
Swissprot: Q9UNE7|STUB1_HUMAN
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0031371 = Cellular component: ubiquitin conjugating enzyme complex
GO:0030544 = Molecular function: Hsp70 protein binding
GO:0030191 = Molecular function: Hsp70/Hsc70 protein inhibitor activity
GO:0051879 = Molecular function: Hsp90 protein binding
GO:0030674 = Molecular function: protein binding, bridging
GO:0046332 = Molecular function: SMAD binding
GO:0030911 = Molecular function: TPR domain binding
GO:0004842 = Molecular function: ubiquitin-protein ligase activity
GO:0032436 = Biological process: positive regulation of proteasomal ubiquitin-dependent protein catabolic process
GO:0031398 = Biological process: positive regulation of protein ubiquitination
GO:0006457 = Biological process: protein folding
GO:0051604 = Biological process: protein maturation
GO:0000209 = Biological process: protein polyubiquitination
GO:0031943 = Biological process: regulation of glucocorticoid metabolic process
GO:0030579 = Biological process: ubiquitin-dependent SMAD protein catabolic process

Sequence:
>SY0AAB42YH19FM1
TTGGCTTCGCTTTCCACTCACAACCTTAACACTCTCTTCTCCTTCGCACG
ATATCATACACACACGACTACGGCATACATATCGCAGCGCAGCGCGGCCT
CCCTATCAAACCATCATCCCTGCGTATTTCCTTCCGACGGCGCCTCCCCC
GGATTTTTCTCCTTTGAGCCTCACTCACGAGTCGAGCTGCTGCGCCCCAC
TGGAATCTCAACATCTAACTTATTGCCTCCCTAACACAAATACCATCCGC
ACCTTTCCCCATTTCTCTATCTCTCGAAGATCGACATTTGTGTCGGTTTC
GTTTCCCGATACGCTCAAAAATTCCAAATTCTCGACAAAGTTCCTTACCT
AGACCAGATGCCTATGAAGGCCGAAGAACTGAAAAATAAGGGGAACGTAA
TTATAAAAGACTCTACGAATGCCGCTTTCTTCACTAATCGTGCGCTAGTA
AGATTGCGCATGGACATGTACGATCAAGTCATAGACGATTGCTTGAAGGC
TATTGATCTCATCCCATCTTCACTGAAAGCATATTCATACCTCGGACAAG
CGCAGC

Sequences in the Contig:

SY0AAB42YH19FM1