Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB42YH01FM1
Length(NT) : 564
Best Gene Model Blast : Link to GSTUMT00001750001 E-value : 1e-117
Numbers of ESTs : 1

Blast Results:

Nr Definition: glyceraldehyde 3-phosphate dehydrogenase
Accession: gb|AAT76626.1| Score: 496 E_value: 6e-52
KEGG Definition: glyceraldehyde 3-phosphate dehydrogenase [EC:1.2.1.12]; K00134 glyceraldehyde 3-phosphate dehydrogenase
Accession: aor:AO090003001322 Score: 458 E_value: 6e-49
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG0657 Score: 439 E_value: 2e-44
PFAM Definition: Gp_dh_N, Glyceraldehyde 3-phosphate dehydrogenase, NAD binding domain. GAPDH is a tetrameric NAD-binding enzyme involved in glycolysis and glyconeogenesis. N-terminal domain is a Rossmann NAD(P) binding fold..
Pfam Number: pfam00044 Score: 454 E_value: 3e-46
Swissprot: Q9P8C0|G3P_PHANO

Sequence:
>SY0AAB42YH01FM1
TTGGAACATTTTACTCGCTTTACACTCCAGGTTCTCAATTCAAAATGGCC
GTCCCCATTGGTATTAACGGCTTTGGTCGCATCGGACGTCTTGTATGTTC
ATCCGTCTAACCTTTTGATTATCCTCCATCCGTAGATAATTCTTTCACCG
GATGAATATTTCTGGCTTACTTTTGTGGTAAATATCCGCCGAACGCGACG
ACGTCAGGGTTGTAGCTGTTAACGATCCCTTCATCGATCCTAAATATGCG
GTCTACATGTTCAAGTACGATTCCGCTCATGGAAATTTTAAGGGAGAGGT
TAGCACCAACGATGCTGGCGACTTGGTTGTCAATGGAAAGACTATCAGGA
TGTACTCCGAGAGGGACCCTGCCAATATCCCATGGGGAGCTGCTGGTGCT
GAATACGTCGTTGAGTCTACTGGTGTTTTTACTACCACCGAAAAGGCGAG
CGCTCACTTGAAGGGCGGTGCCAGGAAGGTTATCATTTCGGCTCCTTCTG
CCGACGCTCCCATGTTCGTTGTTGGTGTAAACTTGGATAAATATAACAAA
GACATTACTGTTCT

Sequences in the Contig:

SY0AAB42YH01FM1