Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB42YF22FM1
Length(NT) : 586
Best Gene Model Blast : Link to GSTUMT00007541001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_06939
Accession: ref|XP_001554351.1| Score: 435 E_value: 2e-41
KEGG Definition: hypothetical protein
Accession: spo:SPCC736.11 Score: 407 E_value: 1e-38
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG1041 Score: 403 E_value: 2e-40
PFAM Definition: Piwi, Piwi domain. This domain is found in the protein Piwi and its relatives. The function of this domain is the dsRNA guided hydrolysis of ssRNA. Determination of the crystal structure of Argonaute reveals that PIWI is an RNase H domain, and identifies Argonaute as Slicer, the enzyme that cleaves mRNA in the RNAi RISC complex. In addition, Mg+2 dependence and production of 3'-OH and 5' phosphate products are shared characteristics of RNaseH and RISC. The PIWI domain core has a tertiary structure belonging to the RNase H family of enzymes. RNase H fold proteins all have a five-stranded mixed beta-sheet surrounded by helices. By analogy to RNase H enzymes which cleave single-stranded RNA guided by the DNA strand in an RNA/DNA hybrid, the PIWI domain can be inferred to cleave single-stranded RNA, for example mRNA, guided by double stranded siRNA..
Pfam Number: pfam02171 Score: 354 E_value: 1e-34
Swissprot: O74957|AGO1_SCHPO
Gene Ontology:
GO:0033167 = Cellular component: ARC complex
GO:0005721 = Cellular component: centric heterochromatin
GO:0005829 = Cellular component: cytosol
GO:0031934 = Cellular component: mating-type region heterochromatin
GO:0005724 = Cellular component: nuclear telomeric heterochromatin
GO:0030958 = Cellular component: RITS complex
GO:0005515 = Molecular function: protein binding
GO:0030702 = Biological process: chromatin silencing at centromere
GO:0007059 = Biological process: chromosome segregation
GO:0051570 = Biological process: regulation of histone H3-K9 methylation
GO:0033168 = Biological process: RNA interference, conversion of ds siRNA to ss siRNA
GO:0031048 = Biological process: chromatin silencing by small RNA

Sequence:
>SY0AAB42YF22FM1
TTGGATAACCCAAAGATCACTGTCACCATTTGCTCTAAGCGTCATCATAC
TCGCTTTTTCCCAGTCGAGCGCAACGCGCAAGACAGGAACGGCAATTGCC
TCCCTGGAACAATCGTTGAACGTGATGTTACTCATCCAACCGAATACGAT
TTCTACCTTGCGGCTCATAATGCCATCCAAGGGACTGCGCGCCCGGTTCA
CTATCATGTCATCCATGATGAAAACAAAATGCCGGTTGATATGTTCCAGG
CGTTGGTTTACAACTCCTGCTACACTTACATTCGCGCCAGTAATTCTGTG
TCATTGATCCCGGCGGTTTATTACGCCCATCTAGCATCATCTCGTGCCCG
TGCTCATGAGGTTGCTGATGAGGGCAATACAATCACGACCACTACTTCTG
GTGAGAAGAGGGACCCGGGCGATGTGGCTGATATTAGGCCTCTTCATGAT
ACCATCAAACATGCCATGTGGTATGTTTAAGGGGCCATGCCATGCCATCG
GGGGTAGCATTGATCGTGATTTCAACTTTCGTTCCTATTTTTCCATGTAT
GTTTGGATTCTGTATGGGGCGCAACTTTTAGTTTTC

Sequences in the Contig:

SY0AAB42YF22FM1