Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB42YF07FM1
Length(NT) : 569
Best Gene Model Blast : Link to GSTUMT00007910001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001213559.1| Score: 258 E_value: 5e-21
KEGG Definition: hypothetical protein
Accession: fgr:FG11425.1 Score: 250 E_value: 2e-20
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB42YF07FM1
TTGGAAGATATACAAATTCTGCGCTGGCTCTCTCCCCTGGAGCCAAACAA
CAGACACGAAGGAGTTCGTGCCGAGCGATTTGCAGGTGTCGGCGATTGGC
TGTTGGAAACACGCGAGTTTCGGGTATGGAGAGGTTGTGAGGGTGGAGTC
GATAAACCTGTCTTGTTCTGCAGCGGGAATCCGGGAGTGGGAAAGACGTA
CATAAGCTCCCTTGTTATCGACAGCCTGTGCGATCAGGCAGGGAAGGAGA
ATATCGCCGTCGCAGGCCTGTACTGCGACTTCCTAGCTCAGCAGGAACAG
ACAATTACCAACGTGATGGGAGCTATCTTCAAGCAACTCGTCGCCAGAGG
GGACATGCCGAATGATCTGCGGGAGGCATTTGAGAAAGCGAAAAAGGGGT
TTGGTGGCAGAAGGCTGCTACTTCCGGATCTGGTGAAAATGCTGAGGACT
GCGATCGCTTCGCTACCCATAGTATTCATCTGTATTGATGCGCTAGACGA
ATTCTCACCGAAGCATCTCCCGGAACTTCTAAAGTTGTTGGGAGATATTG
TTCGGGAGTCCCCTACTAC

Sequences in the Contig:

SY0AAB42YF07FM1