Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB42YD19FM1
Length(NT) : 539
Best Gene Model Blast : Link to GSTUMT00004186001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_00827
Accession: ref|XP_001247056.1| Score: 839 E_value: 2e-88
KEGG Definition: acetyl-CoA carboxylase [EC:6.3.4.14 6.4.1.2]; K01946 biotin carboxylase; K01961 acetyl-CoA carboxylase
Accession: aor:AO090011000838 Score: 819 E_value: 2e-86
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG0368 Score: 869 E_value: 2e-94
PFAM Definition: Carboxyl_trans, Carboxyl transferase domain. All of the members in this family are biotin dependent carboxylases. The carboxyl transferase domain carries out the following reaction; transcarboxylation from biotin to an acceptor molecule. There are two recognised types of carboxyl transferase. One of them uses acyl-CoA and the other uses 2-oxoacid as the acceptor molecule of carbon dioxide. All of the members in this family utilise acyl-CoA as the acceptor molecule..
Pfam Number: pfam01039 Score: 479 E_value: 3e-49
Swissprot: P78820|ACAC_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005774 = Cellular component: vacuolar membrane
GO:0000920 = Biological process: cell separation during cytokinesis
GO:0007059 = Biological process: chromosome segregation
GO:0000280 = Biological process: nuclear division

Sequence:
>SY0AAB42YD19FM1
TTGGCGGAAAGGATGACGAAGAAGAATACCTTTCTGGTCTGTTTGATAAG
GGGTCCTTCCAGGAGACTCTTATCGGGTGGGCTAGAACCGTCGTTGTCGG
CCGCGCTCGCATTGCTGGTATCCCCATTGGTGTCATTGCCGTTGAAACCC
GCTCGGTTGAGAATGTCACCCCTGCTGATCCGGCTAACCCTGACTCTACG
GAAATGGTCTCGCTTGAGGCTGGTCAGGTCTGGTACCCTAACTCTGCGTT
CAAGACTGCTCAGGCTATCAACGATTTCAATCGCGGGGAGCAATTGCCGT
TAATGATCCTTGCCAACTGGCGTGGATTCTCCGGCGGTCAGAGGGATATG
TACAACGAGGTGCTGAAGTATGGATCTATGATTGTCGATGCTCTTGTCAA
GTATGAGCAGCCGATTTTTGTCTACATTCCACCTTTTGGCGAGCTTCGTG
GTGGTTCATGGGTCGTGGTGGATCCTACTATCAATCCAAGCATGATGGAG
ATGTATGCCGACGAGGAATCCCGCGCCGGTGTCCTTGAG

Sequences in the Contig:

SY0AAB42YD19FM1