Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB42YD04FM1
Length(NT) : 547
Best Gene Model Blast : Link to GSTUMT00003136001 E-value : 1e-156
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_03226
Accession: ref|XP_001558194.1| Score: 356 E_value: 2e-41
KEGG Definition: hypothetical protein
Accession: ncr:NCU09741.1 Score: 355 E_value: 9e-42
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG1158 Score: 246 E_value: 4e-22
PFAM Definition: No Hit Found
Swissprot: Q00141|NCPR_ASPNG
Gene Ontology:
GO:0005792 = Cellular component: microsome
GO:0009055 = Molecular function: electron carrier activity
GO:0006118 = Biological process: electron transport

Sequence:
>SY0AAB42YD04FM1
TTGGCGAGAGGATTGGAAAGACATTGCTGTTTTTTGGTTGTAGGAAAGCT
TCTGAGGATTTCCTATACCAAGAAGAATGGAAGATTCGTTCTCACTCATC
ACCGCTTTCTCACGTGACGGACCTGAGAAGGTGTACGTGCAGCACAGACT
GAAAGAGCGCGCCAAAGAAGTTAATGAGCTTTTGGCACAAGGTAGCTACT
TCTATGTTTGCGGAGACGCTGCCCACATGGCCAGAGAGGTCAATACCTCC
CTCGGAAGCATCATCGCTCAGGAGAGGGGTTTGACAGAGACTCAAGGAGA
GGAAATCGTCAAGAGACTGAGATCTAGCAATCTATACCAGGAGGATGTCT
GGTCATAATCGACTGGAAGCGGCCTCGGCACGCTAGTGCTGACGTTTCCC
GACGTTTTCCATGTTTCTCTTTTCTTTCTTTCTTTTTAGCGCTTGTTGGA
GAATTATTTCCCCCGGCTTTCATGTCCTTCGTTCTATTGCCAATAGGGAT
AGACCATGATGAATTTCAATTTCCCTTCTGTTTCTTTTAAGTGCTGG

Sequences in the Contig:

SY0AAB42YD04FM1