Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB42YB04FM1
Length(NT) : 582
Best Gene Model Blast : Link to GSTUMT00008885001 E-value : 1e-166
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein AN1493.2
Accession: ref|XP_659097.1| Score: 273 E_value: 9e-23
KEGG Definition: hypothetical protein
Accession: ani:AN1493.2 Score: 273 E_value: 5e-23
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB42YB04FM1
TTGGCAGGCTCGACATCTCACACTCGTTTAGAGAACTACTCCCATTTAAT
AACCCCCCTTCACGATAATCACAATATTCTCTCTTGCGAGTCGACAATTC
CTCTTAGAACAAACAAACGCCGAAATTCAAAATGAAGTCATTCGTTCTTA
CCGCTTTTGTTGTCGCCTCGTCTGCCCTGTCTGTGTCCGCACAGGTGTAT
CCTCCTTTTAATGTCACTGCTGTGTAAGTCTACTATCAGATTGCTATTAG
CTATACCTCGGATACGACTAATACGAATCTTGTTACTAGCCCGGAGGCCG
AAAGGATTCAGTGGTGCAAAGCCCAGACCGCTGCATGCCCTCTTTTGTGT
GGTGATCAGGATAAGACTGCTGCGCAGAACAAGTGCTTCCCAGATAATCT
CTATTTCACTTGCGTTTGCAACGACGGCACCTCGCCCAATTTGACCGAGT
ACTCTCAAACTATCCCTTACTTCCGCTGCCAGGCCGAGGTCAAGGGTTGC
TCCGATGCCTGCACCGGTAACTCGAAATGCCAGTCCGCTTGTACCGCGAA
TAGGCCATGTGGTGCCACCGATCCTCAGCGTC

Sequences in the Contig:

SY0AAB42YB04FM1