Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB42YA21FM1
Length(NT) : 516
Best Gene Model Blast : Link to GSTUMT00008041001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001212426.1| Score: 143 E_value: 8e-08
KEGG Definition: hypothetical protein
Accession: ani:AN6927.2 Score: 137 E_value: 2e-07
KOG Definition:
Classification: [Carbohydrate transport and metabolism, Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4157 Score: 131 E_value: 7e-09
PFAM Definition: WSC, WSC domain. This domain may be involved in carbohydrate binding..
Pfam Number: pfam01822 Score: 152 E_value: 3e-11
Swissprot: P34735|YLU2_PICAN

Sequence:
>SY0AAB42YA21FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACAAAG
TTGTCCCCCACCTCCCCCTCCCCGCAACGACTCTTATAATCCTTCTAAAA
GAAAAATAATAATAGTAATAATGAAGATTCTCATCCTCGCCGCAACCCTC
CTCCCCTTTCTCACTTCGGTCGCTGCTCAAGCTCCCCGCTATGCCGGTTG
CTACCGCACGGCGGGCGGCCTCATCCGGGTGGATTCACAGCGCCCCAGCT
GTGCCGAGGCTTGCACTGACGCTGGCAACGCGCCCATCGGAGCGCTGACC
AGGACCAATGAATGCTACTGCGGTACCACTCCGCCACGCGACGAAGATCG
AGCCCCGGATGCCTCGTGTGATTCTCCTTGCCCTGGTGCTCCGGAGTTGG
CTTGTGGAAGCAATTCCGGACAATTCTTCTCGGTTTACTTCTGGACAGGA
GGTCCTTCACCTTCCTCGGGCGCTAATAACGCGACAGTTTCCTCTACTCG
CGGTGGGAACAGAACC

Sequences in the Contig:

SY0AAB42YA21FM1