Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB42YA12FM1
Length(NT) : 262
Best Gene Model Blast : Link to GSTUMT00009922001 E-value : 2e-65
Numbers of ESTs : 1

Blast Results:

Nr Definition: serine/threonine protein kinase (Pdd7p), putative
Accession: gb|EDP50282.1| Score: 250 E_value: 3e-20
KEGG Definition: serine/threonine protein kinase (Pdd7p), putative [EC:2.7.11.1]; K08269 unc51-like kinase
Accession: afm:AFUA_4G09050 Score: 250 E_value: 1e-20
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones, Intracellular trafficking, secretion, and vesicular transport, Signal transduction mechanisms].
Kog Number: KOG0595 Score: 218 E_value: 2e-19
PFAM Definition: Pkinase, Protein kinase domain..
Pfam Number: pfam00069 Score: 143 E_value: 1e-10
Swissprot: A1CX69|ATG1_NEOFI

Sequence:
>SY0AAB42YA12FM1
GCATTTTATGAAGCAACTTGCCAGTGCACTTGAGTACCTAAGAAAATTCG
GATTGGTTCATAGGGATGTAAAGCCACAAAACTTGTTATTAGATCCACCT
GCCGGATATGATTCCAGGACCCCGGTAGCCCAAGGGGAATACGCTCCGGA
TGGCTCGCAGGCACTCGTCGGGCTTCCGTCACTGCCGATCCTCAAGCTTG
CCGATTTTGGATTTGCTAGAAATCTACCCGCTGCCTCCTTGGCAGACACT
TTATGTGGATCG

Sequences in the Contig:

SY0AAB42YA12FM1