Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB41YP01FM1
Length(NT) : 426
Best Gene Model Blast : Link to GSTUMT00002932001 E-value : 1e-126
Numbers of ESTs : 1

Blast Results:

Nr Definition: filamentation protein (Rhf1), putative
Accession: ref|XP_001273991.1| Score: 155 E_value: 3e-09
KEGG Definition: predicted protein
Accession: aor:AO090701000188 Score: 137 E_value: 1e-07
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB41YP01FM1
TTGGGGGCGCGGAGCCTAGAAATATCAAAAGACCAGTCTCATTGCCGGAG
CCTAGGTTAAAAGAAGAAGACGAAAGAAAGAGGGCAGCGGGCGCGCTGAG
GGCAGTTTGGATATTTGTCGGGGGTCTGTATAGGAGAGCGGGACATTTGC
AAGATGCTGCGATGGCCGTCGAGGAGGCAGCTAGTCTGGTGGGCACTAAG
GGCGATGGCGAAGCCGACATGTTGACGCAGAAAGCACTATTGGCATTAGA
GGGAGGCAGAAAAGAACTCTCCACGGAGTTTTTCGACGCAGCCTTATTCG
TGGACGTCAATCACCCGCTAGCCACAGTTGGACTAACTAATATTCTTTTG
GACATATCCGTTGGCCCAAACTCCTCCACTCCTGCCCCAAAGGAGTGTGC
TCTTGCAGCGACCCAGGAAAGCGAAG

Sequences in the Contig:

SY0AAB41YP01FM1